| Detail of EST/Unigene BQ148273 |
| Acc. | BQ148273 |
| Internal Acc. | NF065E08FL1F1067 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase-like protein At1g69295 OS=Arabidopsis thaliana E-value=1e-23; Glucan endo-1,3-beta-glucosidase-like protein 3 OS=Arabidopsis thaliana E-value=4e-22; Glucan endo-1,3-beta-glucosidase-like protein 2 OS=Arabidopsis thaliana E-value=4e-22; Glucan endo-1,3-beta-glucosidase 1 OS=Arabidopsis thaliana E-value=4e-17; Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=6e-14; |
| Length | 687 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | TTCGGCACGAGGCCCACTTTCTCTATTCCAGAAAATCTCCATTCTCCTAGCTACTGTCTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838446 |
| Trichome-related Gene from Literature | N/A |