Detail of EST/Unigene BQ148420 |
Acc. | BQ148420 |
Internal Acc. | NF068B03FL1F1029 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L9, chloroplastic OS=Pisum sativum E-value=3e-58; 50S ribosomal protein L9, chloroplastic OS=Arabidopsis thaliana E-value=1e-48; 50S ribosomal protein L9, chloroplastic OS=Ipomoea trifida E-value=4e-47; 50S ribosomal protein L9, chloroplastic OS=Triticum aestivum E-value=3e-42; 50S ribosomal protein L9 OS=Cyanothece sp. (strain PCC 7424) E-value=7e-23; |
Length | 660 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | ACAGAACACAAATTGAGCGGTGAGTTAACAAAACAACAATGGCATCATCATCAACATTAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 823623 |
Trichome-related Gene from Literature | N/A |