| Detail of EST/Unigene BQ148666 |
| Acc. | BQ148666 |
| Internal Acc. | NF080D01FL1F1014 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L23, chloroplastic OS=Glycine max E-value=3e-24; 50S ribosomal protein L23, chloroplastic OS=Phaseolus angularis E-value=3e-24; 50S ribosomal protein L23, chloroplastic OS=Sinapis alba E-value=3e-24; 50S ribosomal protein L23, chloroplastic OS=Coffea arabica E-value=3e-24; 50S ribosomal protein L23, chloroplastic OS=Arabidopsis thaliana E-value=3e-24; |
| Length | 548 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | CCATCATTTTGAATTTACGTTCAATTTACGTAATTTCTTGATTTCCATCATTTTGAATTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |