Detail of EST/Unigene BQ148666 |
Acc. | BQ148666 |
Internal Acc. | NF080D01FL1F1014 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L23, chloroplastic OS=Glycine max E-value=3e-24; 50S ribosomal protein L23, chloroplastic OS=Phaseolus angularis E-value=3e-24; 50S ribosomal protein L23, chloroplastic OS=Sinapis alba E-value=3e-24; 50S ribosomal protein L23, chloroplastic OS=Coffea arabica E-value=3e-24; 50S ribosomal protein L23, chloroplastic OS=Arabidopsis thaliana E-value=3e-24; |
Length | 548 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | CCATCATTTTGAATTTACGTTCAATTTACGTAATTTCTTGATTTCCATCATTTTGAATTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |