Detail of EST/Unigene BQ148674 |
Acc. | BQ148674 |
Internal Acc. | NF080D04FL1F1042 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S8, chloroplastic OS=Glycine max E-value=2e-51; 30S ribosomal protein S8, chloroplastic OS=Lotus japonicus E-value=2e-50; 30S ribosomal protein S8, chloroplastic OS=Phaseolus angularis E-value=2e-49; 30S ribosomal protein S8, chloroplastic OS=Vitis vinifera E-value=8e-48; 30S ribosomal protein S8, chloroplastic OS=Phaseolus vulgaris E-value=1e-47; |
Length | 627 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | ATTTATAATAGGTCATTCATTCATTTTCTTTCTATCTTTTTTTAGTTTTAGAATATTCTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |