| Detail of EST/Unigene BQ148761 |
| Acc. | BQ148761 |
| Internal Acc. | NF082C08FL1F1065 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase subunit b, chloroplastic OS=Cicer arietinum E-value=8e-20; ATP synthase subunit b, chloroplastic OS=Glycine max E-value=3e-18; ATP synthase subunit b, chloroplastic OS=Coffea arabica E-value=7e-18; ATP synthase subunit b, chloroplastic OS=Liriodendron tulipifera E-value=1e-17; ATP synthase subunit b, chloroplastic OS=Manihot esculenta E-value=4e-17; |
| Length | 698 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | GATTTAACTCCTACAATTTATTCTTCATTTGGATTAACATATGGATTCGCCTTCTTCCGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |