Detail of EST/Unigene BQ148761 |
Acc. | BQ148761 |
Internal Acc. | NF082C08FL1F1065 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase subunit b, chloroplastic OS=Cicer arietinum E-value=8e-20; ATP synthase subunit b, chloroplastic OS=Glycine max E-value=3e-18; ATP synthase subunit b, chloroplastic OS=Coffea arabica E-value=7e-18; ATP synthase subunit b, chloroplastic OS=Liriodendron tulipifera E-value=1e-17; ATP synthase subunit b, chloroplastic OS=Manihot esculenta E-value=4e-17; |
Length | 698 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | GATTTAACTCCTACAATTTATTCTTCATTTGGATTAACATATGGATTCGCCTTCTTCCGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |