| Detail of EST/Unigene BQ148872 |
| Acc. | BQ148872 |
| Internal Acc. | NF083D12FL1F1101 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Allene oxide cyclase 4, chloroplastic OS=Arabidopsis thaliana E-value=6e-63; Allene oxide cyclase 3, chloroplastic OS=Arabidopsis thaliana E-value=4e-62; Allene oxide cyclase 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-59; Allene oxide cyclase 2, chloroplastic OS=Arabidopsis thaliana E-value=3e-59; |
| Length | 687 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | ATCACCTTCAATGGCATCCATGAGTTCTTTGAAAATGATTTCTTCCCTCAACCTTTCTAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837888 |
| Trichome-related Gene from Literature | N/A |