Detail of EST/Unigene BQ148962 |
Acc. | BQ148962 |
Internal Acc. | NF086A06FL1F1040 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Vigna radiata var. radiata E-value=2e-72; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Glycine max E-value=6e-69; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=2e-66; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=5e-64; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Brassica napus E-value=1e-62; |
Length | 461 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | CCTCGTGCCGAATTCGGCACGAGGAGTCATAGAACTCATCATCAAAACCATGGTCATGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830441 |
Trichome-related Gene from Literature | N/A |