| Detail of EST/Unigene BQ149037 |
| Acc. | BQ149037 |
| Internal Acc. | NF086G05FL1F1039 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit XI, chloroplastic OS=Arabidopsis thaliana E-value=7e-25; Photosystem I reaction center subunit XI, chloroplastic OS=Cucumis sativus E-value=6e-24; Photosystem I reaction center subunit XI, chloroplastic OS=Spinacia oleracea E-value=2e-21; Photosystem I reaction center subunit XI, chloroplastic OS=Hordeum vulgare E-value=2e-20; |
| Length | 313 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER; |
| Sequence | CTATGGAGTTTCATCATTCAATGAAGGTGATCCATCAATTGCTCCATCTTTGACCTTAAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826892 |
| Trichome-related Gene from Literature | N/A |