Detail of EST/Unigene BQ149115 |
Acc. | BQ149115 |
Internal Acc. | NF088A06FL1F1040 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S2, chloroplastic OS=Lotus japonicus E-value=0; 30S ribosomal protein S2, chloroplastic OS=Pisum sativum E-value=0; 30S ribosomal protein S2, chloroplastic OS=Eucalyptus globulus subsp. globulus E-value=0; 30S ribosomal protein S2, chloroplastic OS=Vitis vinifera E-value=0; 30S ribosomal protein S2, chloroplastic OS=Cucumis sativus E-value=0; |
Length | 686 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | GAAAAGAGAAGGTTCCATCGGAACAATTATTTATTGCTATTTCAGGATACCTGGTCTCGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |