Detail of EST/Unigene BQ149123 |
Acc. | BQ149123 |
Internal Acc. | NF088A06FL1F1049 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S2, chloroplastic OS=Lotus japonicus E-value=4e-90; 30S ribosomal protein S2, chloroplastic OS=Pisum sativum E-value=6e-90; 30S ribosomal protein S2, chloroplastic OS=Carica papaya E-value=4e-86; 30S ribosomal protein S2, chloroplastic OS=Eucalyptus globulus subsp. globulus E-value=9e-86; 30S ribosomal protein S2, chloroplastic OS=Cucumis sativus E-value=1e-85; |
Length | 653 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | GAAAAGAGAAGGTTCCATCGGAACAATTATTTATTGCTATTTCAGGATACCTGGTCTCGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |