Detail of EST/Unigene BQ149490 |
Acc. | BQ149490 |
Internal Acc. | NF105B04FL1F1041 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Outer envelope pore protein 21, chloroplastic OS=Pisum sativum E-value=8e-11; Outer envelope pore protein 21A, chloroplastic OS=Arabidopsis thaliana E-value=5e-08; Outer envelope pore protein 21B, chloroplastic OS=Arabidopsis thaliana E-value=2e-07; Outer envelope pore protein 21, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-06; Outer envelope pore protein 21, chloroplastic OS=Oryza sativa subsp. indica E-value=2e-06; |
Length | 291 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | GCACGAGGCTCTTGTTCCAGGTTCCTTATGTGCAGATTAGGGAGAATAATTGGACATTTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 1.B.2 Chlamydial porin CP; 1.B.29 Plastid outer-envelope porin of 21 kDa OEP21 |
Probeset |
|
Corresponding NCBI Gene | 838673 |
Trichome-related Gene from Literature | N/A |