Detail of EST/Unigene BQ149599 |
Acc. | BQ149599 |
Internal Acc. | NF106G07FL1F1056 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Inosine triphosphate pyrophosphatase OS=Vitis vinifera E-value=1e-94; Inosine triphosphate pyrophosphatase OS=Arabidopsis thaliana E-value=1e-90; Inosine triphosphate pyrophosphatase OS=Sorghum bicolor E-value=2e-85; Inosine triphosphate pyrophosphatase OS=Oryza sativa subsp. japonica E-value=2e-84; Inosine triphosphate pyrophosphatase OS=Oryza sativa subsp. indica E-value=2e-84; |
Length | 639 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | GCTGTGTTCCAAAAGTCTCGATTCATAGGTTTTCGCCAGAAATATCAAAGAAGATTTGGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01519 nucleoside-triphosphate pyrophosphatase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01519 nucleoside-triphosphate pyrophosphatase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01519 nucleoside-triphosphate pyrophosphatase |
EC | 3.-.-.- 3.6.1.19 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827006 |
Trichome-related Gene from Literature | N/A |