Detail of EST/Unigene BQ149737 |
Acc. | BQ149737 |
Internal Acc. | NF108C10FL1F1081 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L16, chloroplastic OS=Helianthus annuus E-value=2e-38; 50S ribosomal protein L16, chloroplastic OS=Guizotia abyssinica E-value=2e-38; 50S ribosomal protein L16, chloroplastic (Fragment) OS=Vigna unguiculata E-value=4e-38; 50S ribosomal protein L16, chloroplastic OS=Eucalyptus globulus subsp. globulus E-value=2e-36; 50S ribosomal protein L16, chloroplastic OS=Citrus sinensis E-value=3e-36; |
Length | 638 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER; |
Sequence | AAATATTCGCCCGCGAAAATGTGGATTTTTTTGAATTTANAAATTTTTGCCAATATGATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |