Detail of EST/Unigene BQ158028 |
Acc. | BQ158028 |
Internal Acc. | NF016D11PL1F1091 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein of LHCII type I, chloroplastic (Fragment) OS=Cucumis sativus E-value=5e-25; Chlorophyll a-b binding protein of LHCII type 1 (Fragment) OS=Cucumis sativus E-value=5e-25; Chlorophyll a-b binding protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=9e-25; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=9e-25; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=1e-24; |
Length | 836 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
Sequence | ATGATTCGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGC |
EST members of Unigene | BQ158028 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37209.1.S1_s_at
|
Corresponding NCBI Gene | 818006 |
Trichome-related Gene from Literature | N/A |