Detail of EST/Unigene BQ158528 |
Acc. | BQ158528 |
Internal Acc. | NF063D04PL1F1032 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit VI, chloroplastic OS=Brassica rapa E-value=6e-37; Photosystem I reaction center subunit VI-2, chloroplastic OS=Arabidopsis thaliana E-value=2e-36; Photosystem I reaction center subunit VI-1, chloroplastic OS=Arabidopsis thaliana E-value=5e-35; Photosystem I reaction center subunit VI, chloroplastic OS=Spinacia oleracea E-value=3e-32; Photosystem I reaction center subunit VI, chloroplastic OS=Zea mays E-value=5e-32; |
Length | 684 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | CGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGTGGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841653 |
Trichome-related Gene from Literature | N/A |