| Detail of EST/Unigene BQ158528 |
| Acc. | BQ158528 |
| Internal Acc. | NF063D04PL1F1032 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit VI, chloroplastic OS=Brassica rapa E-value=6e-37; Photosystem I reaction center subunit VI-2, chloroplastic OS=Arabidopsis thaliana E-value=2e-36; Photosystem I reaction center subunit VI-1, chloroplastic OS=Arabidopsis thaliana E-value=5e-35; Photosystem I reaction center subunit VI, chloroplastic OS=Spinacia oleracea E-value=3e-32; Photosystem I reaction center subunit VI, chloroplastic OS=Zea mays E-value=5e-32; |
| Length | 684 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | CGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGTGGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841653 |
| Trichome-related Gene from Literature | N/A |