Detail of EST/Unigene BT050628 |
Acc. | BT050628 |
Internal Acc. | |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribosome biogenesis protein NSA2 homolog OS=Dictyostelium discoideum E-value=7e-67; Ribosome biogenesis protein NSA2 homolog OS=Homo sapiens E-value=1e-62; Ribosome biogenesis protein NSA2 homolog OS=Mus musculus E-value=1e-62; Ribosome biogenesis protein NSA2 homolog OS=Bos taurus E-value=1e-62; Ribosome biogenesis protein NSA2 homolog OS=Rattus norvegicus E-value=3e-61; |
Length | 732 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS; |
Sequence | GGAATCCCCCCAACGAGAGTAGCTTCTCGACAAAACTAGTTGTGACTCCGCCAGACTGCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00562 Inositol phosphate metabolism > K00914 phosphatidylinositol 3-kinase; Genetic Information Processing > Folding, Sorting and Degradation > ko04140 Regulation of autophagy > K00914 phosphatidylinositol 3-kinase; Environmental Information Processing > Signal Transduction > ko04070 Phosphatidylinositol signaling system > K00914 phosphatidylinositol 3-kinase |
EC | 2.7.1.137 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830524 |
Trichome-related Gene from Literature | N/A |