Detail of EST/Unigene BT050929 |
Acc. | BT050929 |
Internal Acc. | |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-carotene 3-hydroxylase 1, chloroplastic OS=Arabidopsis thaliana 1 E-value=2e-36; Beta-carotene 3-hydroxylase, chloroplastic OS=Gentiana lutea E-value=2e-36; Beta-carotene 3-hydroxylase 2, chloroplastic OS=Arabidopsis thaliana 2 E-value=9e-36; Beta-carotene hydroxylase 1, chloroplastic OS=Capsicum annuum E-value=5e-35; Beta-carotene hydroxylase 2, chloroplastic (Fragment) OS=Capsicum annuum E-value=6e-35; |
Length | 294 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS; |
Sequence | TTGTTCTCCTACTTATCTCTTTCTCTAGCTCTTCTATCCCTCCCACTTCTTCAACTTCCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |