| Detail of EST/Unigene BT050972 |
| Acc. | BT050972 |
| Internal Acc. | |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Fructose-1,6-bisphosphatase, chloroplastic OS=Pisum sativum E-value=3e-41; Fructose-1,6-bisphosphatase, chloroplastic OS=Brassica napus E-value=9e-39; Fructose-1,6-bisphosphatase, chloroplastic OS=Arabidopsis thaliana E-value=4e-38; Fructose-1,6-bisphosphatase, chloroplastic OS=Triticum aestivum E-value=6e-38; Fructose-1,6-bisphosphatase, chloroplastic OS=Spinacia oleracea E-value=3e-37; |
| Length | 410 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_CDS; |
| Sequence | AATGTATGGGGAATTTGTTTTGACTCAAGAAAATCTCCAAATACCAAAATCAGGGAAAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K03841 fructose-1,6-bisphosphatase I; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K03841 fructose-1,6-bisphosphatase I; Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K03841 fructose-1,6-bisphosphatase I; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K03841 fructose-1,6-bisphosphatase I |
| EC | 3.1.3.11 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824572 |
| Trichome-related Gene from Literature | N/A |