Detail of EST/Unigene BT051345 |
Acc. | BT051345 |
Internal Acc. | |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome b5 OS=Brassica oleracea var. botrytis E-value=5e-40; Cytochrome b5 isoform 1 OS=Arabidopsis thaliana E-value=5e-39; Cytochrome b5 OS=Nicotiana tabacum E-value=1e-38; Probable cytochrome b5 isoform 2 OS=Arabidopsis thaliana E-value=5e-37; Cytochrome b5, seed isoform OS=Nicotiana tabacum E-value=8e-37; |
Length | 753 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS; |
Sequence | GATCGTTGCAACAACTACCGTCTCAAAACTCATCACCAACCTCTGTCAAAATCTTTTGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00530 Aminosugars metabolism > K00326 cytochrome-b5 reductase; Metabolism > Lipid Metabolism > ko00592 alpha-Linolenic acid metabolism > K10226 fatty acid desaturase 2 (delta-6 desaturase); Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10226 fatty acid desaturase 2 (delta-6 desaturase) |
EC | 1.14.19.- 1.6.2.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835438 |
Trichome-related Gene from Literature | N/A |