| Detail of EST/Unigene BT051695 |
| Acc. | BT051695 |
| Internal Acc. | |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Tyrosine aminotransferase OS=Arabidopsis thaliana E-value=0; Probable aminotransferase TAT4 OS=Arabidopsis thaliana E-value=3e-82; Probable aminotransferase TAT2 OS=Arabidopsis thaliana E-value=2e-80; Tyrosine aminotransferase OS=Mus musculus E-value=2e-69; Tyrosine aminotransferase OS=Bos taurus E-value=4e-69; |
| Length | 1461 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_CDS; |
| Sequence | GACGTAGTTATATCCGAGAAAGAAACCAAACAAGCTCAAAAAACAAACATGGAAAGTGGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00950 Alkaloid biosynthesis I > K00815 tyrosine aminotransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00401 Novobiocin biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00400 Phenylalanine, tyrosine and tryptophan biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00815 tyrosine aminotransferase |
| EC | 2.6.1.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 833613 |
| Trichome-related Gene from Literature | N/A |