Detail of EST/Unigene BT051695 |
Acc. | BT051695 |
Internal Acc. | |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Tyrosine aminotransferase OS=Arabidopsis thaliana E-value=0; Probable aminotransferase TAT4 OS=Arabidopsis thaliana E-value=3e-82; Probable aminotransferase TAT2 OS=Arabidopsis thaliana E-value=2e-80; Tyrosine aminotransferase OS=Mus musculus E-value=2e-69; Tyrosine aminotransferase OS=Bos taurus E-value=4e-69; |
Length | 1461 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS; |
Sequence | GACGTAGTTATATCCGAGAAAGAAACCAAACAAGCTCAAAAAACAAACATGGAAAGTGGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00950 Alkaloid biosynthesis I > K00815 tyrosine aminotransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00401 Novobiocin biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00400 Phenylalanine, tyrosine and tryptophan biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00815 tyrosine aminotransferase |
EC | 2.6.1.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833613 |
Trichome-related Gene from Literature | N/A |