| Detail of EST/Unigene BT051814 |
| Acc. | BT051814 |
| Internal Acc. | |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome c1-1, heme protein, mitochondrial OS=Solanum tuberosum E-value=0; Cytochrome c1-2, heme protein, mitochondrial (Fragment) OS=Solanum tuberosum E-value=0; Cytochrome c1, heme protein, mitochondrial OS=Mus musculus E-value=9e-58; Cytochrome c1, heme protein, mitochondrial OS=Bos taurus E-value=3e-57; Cytochrome c1, heme protein, mitochondrial OS=Homo sapiens E-value=2e-56; |
| Length | 1210 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_CDS; |
| Sequence | GACTGCTTCTTTTCTTCATTCTTCCTTCCAATCTTCATTCCCAATTTGCTTCCATTATTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00190 Oxidative phosphorylation > K00413 ubiquinol-cytochrome c reductase cytochrome c1 subunit |
| EC | 1.10.2.2 |
| Transcription Factor Family | |
| Transporter Classification Family | 3.D.3 Proton-translocating quinol-cyt c reductase superfamily QCR |
| Probeset |
|
| Corresponding NCBI Gene | 834081 |
| Trichome-related Gene from Literature | N/A |