Detail of EST/Unigene BT051849 |
Acc. | BT051849 |
Internal Acc. | |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=0; Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=4e-91; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=1e-82; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=2e-79; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=5e-79; |
Length | 1555 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS; |
Sequence | GGTATTGTGTATACACTGTTTTCAGTTCACTCAGATGAAGTTGGCTTTATAACACCATCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829599 |
Trichome-related Gene from Literature | N/A |