Detail of EST/Unigene BT051942 |
Acc. | BT051942 |
Internal Acc. | |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 10 OS=Arabidopsis thaliana E-value=0; Probable beta-1,3-galactosyltransferase 9 OS=Arabidopsis thaliana E-value=0; Probable beta-1,3-galactosyltransferase 11 OS=Arabidopsis thaliana E-value=1e-69; Probable beta-1,3-galactosyltransferase 3 OS=Arabidopsis thaliana E-value=6e-51; Probable beta-1,3-galactosyltransferase 2 OS=Arabidopsis thaliana E-value=1e-50; |
Length | 1258 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS; |
Sequence | GAGCGATGGATACATTACCAACAACATCGTCGTCGAAGCGAGGTGGAGGAGGAGGAAGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.4.1.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829344 |
Trichome-related Gene from Literature | N/A |