| Detail of EST/Unigene BT051942 |
| Acc. | BT051942 |
| Internal Acc. | |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 10 OS=Arabidopsis thaliana E-value=0; Probable beta-1,3-galactosyltransferase 9 OS=Arabidopsis thaliana E-value=0; Probable beta-1,3-galactosyltransferase 11 OS=Arabidopsis thaliana E-value=1e-69; Probable beta-1,3-galactosyltransferase 3 OS=Arabidopsis thaliana E-value=6e-51; Probable beta-1,3-galactosyltransferase 2 OS=Arabidopsis thaliana E-value=1e-50; |
| Length | 1258 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_CDS; |
| Sequence | GAGCGATGGATACATTACCAACAACATCGTCGTCGAAGCGAGGTGGAGGAGGAGGAAGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 2.4.1.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829344 |
| Trichome-related Gene from Literature | N/A |