Detail of EST/Unigene BT051977 |
Acc. | BT051977 |
Internal Acc. | |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=6e-85; Glucan endo-1,3-beta-glucosidase, acidic isoform GL161 OS=Nicotiana tabacum E-value=2e-78; Glucan endo-1,3-beta-glucosidase, acidic isoform GL153 OS=Nicotiana tabacum E-value=9e-78; Lichenase OS=Nicotiana plumbaginifolia E-value=6e-77; Glucan endo-1,3-beta-glucosidase, basic isoform OS=Prunus persica E-value=1e-76; |
Length | 1196 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS; |
Sequence | GATTCAAAGAGTTGATTTAGCTTATAGTTTTCATATAGTTAAAACCAACACAGCCATGTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827320 |
Trichome-related Gene from Literature | N/A |