Detail of EST/Unigene BT052065 |
Acc. | BT052065 |
Internal Acc. | |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phosphoribulokinase, chloroplastic OS=Mesembryanthemum crystallinum E-value=0; Phosphoribulokinase, chloroplastic OS=Triticum aestivum E-value=0; Phosphoribulokinase, chloroplastic OS=Spinacia oleracea E-value=0; Phosphoribulokinase, chloroplastic OS=Arabidopsis thaliana E-value=0; Phosphoribulokinase, chloroplastic OS=Chlamydomonas reinhardtii E-value=0; |
Length | 1502 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS; |
Sequence | GAAACTCACTTCTTCTTCAAAAAATAAATTCTTTACCTTAGAGAGAAAGAGAGAACAATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.7.1.48 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840098 |
Trichome-related Gene from Literature | N/A |