| Detail of EST/Unigene BT052203 |
| Acc. | BT052203 |
| Internal Acc. | |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Beta-carotene hydroxylase 2, chloroplastic (Fragment) OS=Capsicum annuum E-value=6e-64; Beta-carotene 3-hydroxylase, chloroplastic OS=Gentiana lutea E-value=2e-62; Beta-carotene hydroxylase 1, chloroplastic OS=Capsicum annuum E-value=2e-56; Beta-carotene 3-hydroxylase 1, chloroplastic OS=Arabidopsis thaliana 1 E-value=6e-56; Beta-carotene 3-hydroxylase 2, chloroplastic OS=Arabidopsis thaliana 2 E-value=5e-55; |
| Length | 734 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_CDS; |
| Sequence | GGAACACAACACCGCAAAATTGTGGTTTATAATCAATCCCTTCTCTTCTTTCACTATCTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |