Detail of EST/Unigene BT052407 |
Acc. | BT052407 |
Internal Acc. | |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable plastid-lipid-associated protein 4, chloroplastic OS=Arabidopsis thaliana E-value=1e-60; Probable plastid-lipid-associated protein 5, chloroplastic OS=Arabidopsis thaliana E-value=1e-54; Probable plastid-lipid-associated protein 6, chloroplastic OS=Arabidopsis thaliana E-value=6e-10; Probable plastid-lipid-associated protein 12, chloroplastic OS=Arabidopsis thaliana E-value=3e-09; Plastoglobulin-1, chloroplastic OS=Pisum sativum E-value=2e-08; |
Length | 1005 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS; |
Sequence | GAAGGGAATGTTAACAAGAGGCAATTAGTGCATAAGCATGACTTATCGCTCAGCAGTTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822204 |
Trichome-related Gene from Literature | N/A |