| Detail of EST/Unigene BT052407 |
| Acc. | BT052407 |
| Internal Acc. | |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable plastid-lipid-associated protein 4, chloroplastic OS=Arabidopsis thaliana E-value=1e-60; Probable plastid-lipid-associated protein 5, chloroplastic OS=Arabidopsis thaliana E-value=1e-54; Probable plastid-lipid-associated protein 6, chloroplastic OS=Arabidopsis thaliana E-value=6e-10; Probable plastid-lipid-associated protein 12, chloroplastic OS=Arabidopsis thaliana E-value=3e-09; Plastoglobulin-1, chloroplastic OS=Pisum sativum E-value=2e-08; |
| Length | 1005 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_CDS; |
| Sequence | GAAGGGAATGTTAACAAGAGGCAATTAGTGCATAAGCATGACTTATCGCTCAGCAGTTCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822204 |
| Trichome-related Gene from Literature | N/A |