Detail of EST/Unigene BT052414 |
Acc. | BT052414 |
Internal Acc. | |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome c1-1, heme protein, mitochondrial OS=Solanum tuberosum E-value=0; Cytochrome c1-2, heme protein, mitochondrial (Fragment) OS=Solanum tuberosum E-value=0; Cytochrome c1, heme protein, mitochondrial OS=Mus musculus E-value=1e-77; Cytochrome c1, heme protein, mitochondrial OS=Homo sapiens E-value=8e-77; Cytochrome c1, heme protein, mitochondrial OS=Bos taurus E-value=8e-77; |
Length | 1428 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS; |
Sequence | GACCTCCCAAGTCCCAATTGACTCTTCTTCAATCACCAACTTCTCTCTTTCTCTCTGCAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00190 Oxidative phosphorylation > K00413 ubiquinol-cytochrome c reductase cytochrome c1 subunit |
EC | 1.10.2.2 |
Transcription Factor Family | |
Transporter Classification Family | 3.D.3 Proton-translocating quinol-cyt c reductase superfamily QCR |
Probeset |
|
Corresponding NCBI Gene | 822343 |
Trichome-related Gene from Literature | N/A |