Detail of EST/Unigene BT052457 |
Acc. | BT052457 |
Internal Acc. | |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Replication factor C subunit 4 OS=Homo sapiens E-value=8e-97; Replication factor C subunit 4 OS=Mus musculus E-value=9e-96; Probable replication factor C subunit 4 OS=Dictyostelium discoideum E-value=7e-93; Replication factor C subunit 2 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=2e-84; Replication factor C subunit 2 OS=Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173) E-value=6e-82; |
Length | 1188 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS; |
Sequence | GAGCAGAGAATCGTGTGTGAAGAGAAAATTACTAATATGGCGCCAATCATTCAGAGCACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10755 replication factor C subunit 2/4 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838771 |
Trichome-related Gene from Literature | N/A |