Detail of EST/Unigene BT052593 |
Acc. | BT052593 |
Internal Acc. | |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Aspartate carbamoyltransferase 2, chloroplastic OS=Pisum sativum E-value=0; Aspartate carbamoyltransferase 3, chloroplastic OS=Pisum sativum E-value=0; Aspartate carbamoyltransferase 1, chloroplastic OS=Pisum sativum E-value=0; Aspartate carbamoyltransferase, chloroplastic OS=Arabidopsis thaliana E-value=0; Aspartate carbamoyltransferase OS=Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440) E-value=3e-71; |
Length | 1340 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS; |
Sequence | GGCGAGATTAATTGAGAAGATTGTCTTCTCTTCTCAATTTCACAGTTTTGCAGTTCACAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase |
EC | 2.1.3.2 3.5.2.3 6.3.4.16 6.3.5.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821577 |
Trichome-related Gene from Literature | N/A |