Detail of EST/Unigene BT052605 |
Acc. | BT052605 |
Internal Acc. | |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=1e-37; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=2e-37; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=9e-37; 28 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=1e-35; 29 kDa ribonucleoprotein B, chloroplastic OS=Nicotiana sylvestris E-value=6e-35; |
Length | 1144 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS; |
Sequence | GCAATTCAATGTATGATTTTCATTGAGACAAGAATGAAAGAAGCAATATAACATAGCCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842294 |
Trichome-related Gene from Literature | N/A |