Detail of EST/Unigene BT052835 |
Acc. | BT052835 |
Internal Acc. | |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Malate dehydrogenase, glyoxysomal OS=Cucumis sativus E-value=0; Malate dehydrogenase, glyoxysomal OS=Arabidopsis thaliana E-value=0; Malate dehydrogenase, glyoxysomal OS=Citrullus lanatus E-value=0; Malate dehydrogenase 2, glyoxysomal OS=Brassica napus E-value=0; Malate dehydrogenase 1, glyoxysomal OS=Brassica napus E-value=0; |
Length | 1289 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS; |
Sequence | GGTCCTGTTTTTTCACACCCCATAATATAATATACTATAACCATTCAACTTCAGCACACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K00026 malate dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00026 malate dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00026 malate dehydrogenase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00026 malate dehydrogenase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K00026 malate dehydrogenase |
EC | 1.1.1.37 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816808 |
Trichome-related Gene from Literature | N/A |