Detail of EST/Unigene BT052917 |
Acc. | BT052917 |
Internal Acc. | |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Protein midA, mitochondrial OS=Dictyostelium discoideum E-value=9e-82; Protein midA homolog, mitochondrial OS=Mus musculus E-value=3e-69; Protein midA homolog, mitochondrial OS=Drosophila melanogaster E-value=3e-69; Protein midA homolog, mitochondrial OS=Danio rerio E-value=3e-68; Protein midA homolog, mitochondrial OS=Rattus norvegicus E-value=4e-67; |
Length | 1754 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS; |
Sequence | GACTAAGGATTAGTAGTCTGTTCATAAGCCAGTGGAGTGCAATATATTGATCCCATAATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822500 |
Trichome-related Gene from Literature | N/A |