| Detail of EST/Unigene BT052917 |
| Acc. | BT052917 |
| Internal Acc. | |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Protein midA, mitochondrial OS=Dictyostelium discoideum E-value=9e-82; Protein midA homolog, mitochondrial OS=Mus musculus E-value=3e-69; Protein midA homolog, mitochondrial OS=Drosophila melanogaster E-value=3e-69; Protein midA homolog, mitochondrial OS=Danio rerio E-value=3e-68; Protein midA homolog, mitochondrial OS=Rattus norvegicus E-value=4e-67; |
| Length | 1754 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_CDS; |
| Sequence | GACTAAGGATTAGTAGTCTGTTCATAAGCCAGTGGAGTGCAATATATTGATCCCATAATA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822500 |
| Trichome-related Gene from Literature | N/A |