Detail of EST/Unigene BT053360 |
Acc. | BT053360 |
Internal Acc. | |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S3, chloroplastic OS=Lotus japonicus E-value=3e-95; 30S ribosomal protein S3, chloroplastic OS=Glycine max E-value=8e-91; 30S ribosomal protein S3, chloroplastic OS=Olimarabidopsis pumila E-value=1e-88; 30S ribosomal protein S3, chloroplastic OS=Nasturtium officinale E-value=1e-88; 30S ribosomal protein S3, chloroplastic OS=Capsella bursa-pastoris E-value=1e-88; |
Length | 1111 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS; |
Sequence | GACTCATTTCATTTTTTCGTGAAAATATAACCTTAGGAGAAAGCAGAACCAATACATAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |