Detail of EST/Unigene BT053516 |
Acc. | BT053516 |
Internal Acc. | |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 3-2, chloroplastic OS=Zea mays E-value=8e-12; Oxygen-evolving enhancer protein 3-1, chloroplastic OS=Zea mays E-value=4e-11; Oxygen-evolving enhancer protein 3-1, chloroplastic OS=Arabidopsis thaliana E-value=5e-11; Oxygen-evolving enhancer protein 3, chloroplastic OS=Spinacia oleracea E-value=7e-11; Oxygen-evolving enhancer protein 3-2, chloroplastic OS=Arabidopsis thaliana E-value=3e-10; |
Length | 799 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS; |
Sequence | GAATAAAAACCTGCCCAAAAATTTCCATAGTCCAAATACACCATTCAAAATTCACACCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837974 |
Trichome-related Gene from Literature | N/A |