Detail of EST/Unigene BW686412 |
Acc. | BW686412 |
Internal Acc. | BW686412 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Solanum lycopersicum E-value=0; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=0; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=0; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Zea mays E-value=0; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Glycine max E-value=0; |
Length | 774 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_MicroFRUIT2; |
Sequence | TGTCAAAGGCACTCAACTTTATAAACCCTGACGAACTTTCAATGCAGTGCATTTTGATCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827061 |
Trichome-related Gene from Literature | 827061 |