Detail of EST/Unigene BW691334 |
Acc. | BW691334 |
Internal Acc. | BW691334 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Hexokinase-1 OS=Nicotiana tabacum E-value=9e-34; Hexokinase-2 OS=Solanum tuberosum E-value=2e-31; Hexokinase-1 OS=Arabidopsis thaliana E-value=4e-28; Hexokinase-1 OS=Spinacia oleracea E-value=2e-27; Hexokinase-2 OS=Arabidopsis thaliana E-value=3e-27; |
Length | 222 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_MicroFRUIT2; |
Sequence | AATGGGGTCGTGCTATGGCTATTCTTCGTGAATTTGAAGAAAAGTGTAAGACTCAAGATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00530 Aminosugars metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00844 hexokinase |
EC | 2.7.1.1 2.7.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829034 |
Trichome-related Gene from Literature | 829034 |