Detail of EST/Unigene CA857828 |
Acc. | CA857828 |
Internal Acc. | EST635083 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Putative transferase CAF17 homolog, mitochondrial OS=Mus musculus E-value=3e-26; Putative transferase CAF17 homolog, mitochondrial OS=Danio rerio E-value=4e-25; Putative transferase CAF17, mitochondrial OS=Homo sapiens E-value=1e-24; Putative transferase CAF17, mitochondrial OS=Ustilago maydis (strain 521 / FGSC 9021) E-value=1e-18; Putative transferase CAF17, mitochondrial OS=Magnaporthe oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958) E-value=6e-15; |
Length | 604 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD; |
Sequence | TTGGCTTCGAGGGATCTTCCCATCATATATCATTCCACCTCTAATTGAGGCTGACAAAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826821 |
Trichome-related Gene from Literature | N/A |