Detail of EST/Unigene CA858169 |
Acc. | CA858169 |
Internal Acc. | EST635424 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase F9 OS=Arabidopsis thaliana E-value=3e-76; Glutathione S-transferase F10 OS=Arabidopsis thaliana E-value=5e-69; Glutathione S-transferase F11 OS=Arabidopsis thaliana E-value=2e-51; Glutathione S-transferase F12 OS=Arabidopsis thaliana E-value=8e-47; Glutathione S-transferase F13 OS=Arabidopsis thaliana E-value=1e-45; |
Length | 818 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD; |
Sequence | ATGGTAGTGAAGGTGTATGGTCCCCACTGTGCCTCAGCCAAACGAGTGTTGGTTTGTCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817636 |
Trichome-related Gene from Literature | N/A |