Detail of EST/Unigene CA858200
Acc. CA858200
Internal Acc. EST635455
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 26S protease regulatory subunit 8 homolog B OS=Arabidopsis thaliana E-value=1e-12; 26S protease regulatory subunit 8 homolog A OS=Arabidopsis thaliana E-value=1e-12; 26S protease regulatory subunit 8 OS=Dictyostelium discoideum E-value=2e-10; 26S protease regulatory subunit 8 homolog OS=Naegleria fowleri E-value=9e-10; 26S protease regulatory subunit 8 OS=Manduca sexta E-value=1e-09;
Length 107 nt
Species Medicago truncatula
Belonged EST Libraries GLSD;
Sequence GTTATGGCCAGGGAGCATGCCCCATCAATTATCTTCATGGACGAAATTGACAGTATTGGA
TCTGCTCGTATGGAATCTGGAAGTGGCAATGGTGATAGTGAAGTGCA
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology Genetic Information Processing > Folding, Sorting and Degradation > ko03050 Proteasome > K03066 26S proteasome regulatory subunit T6
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 832122 
Trichome-related Gene from Literature N/A