Detail of EST/Unigene CA858217 |
Acc. | CA858217 |
Internal Acc. | EST635472 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Acyl-coenzyme A oxidase 2, peroxisomal OS=Arabidopsis thaliana E-value=0; Acyl-coenzyme A oxidase, peroxisomal OS=Cucurbita maxima E-value=0; Acyl-coenzyme A oxidase-like protein OS=Mus musculus E-value=6e-29; Acyl-coenzyme A oxidase-like protein OS=Homo sapiens E-value=2e-25; Peroxisomal acyl-coenzyme A oxidase 1 OS=Homo sapiens E-value=6e-24; |
Length | 846 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD; |
Sequence | ACGCTCATATGAAGAAGTCTCATGATGAAGAATTAGTTGCAGATGTCCATGCTCTCTCGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00592 alpha-Linolenic acid metabolism > K00232 acyl-CoA oxidase; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K00232 acyl-CoA oxidase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00232 acyl-CoA oxidase |
EC | 1.3.3.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836635 |
Trichome-related Gene from Literature | N/A |