Detail of EST/Unigene CA858746 |
Acc. | CA858746 |
Internal Acc. | EST636001 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | SKP1-like protein 20 OS=Arabidopsis thaliana E-value=1e-65; SKP1-like protein 21 OS=Arabidopsis thaliana E-value=2e-65; SCF ubiquitin ligase complex protein SKP1b OS=Dictyostelium discoideum E-value=9e-14; SCF ubiquitin ligase complex protein SKP1a OS=Dictyostelium discoideum E-value=1e-13; SKP1-like protein 1A OS=Arabidopsis thaliana E-value=2e-12; |
Length | 616 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD; |
Sequence | GGTTTGATTCCTGTCTGCATAGTCTCCTACGCCGCCACAACCCTTCATCTCGAAGAATCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03094 S-phase kinase-associated protein 1; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K03094 S-phase kinase-associated protein 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03094 S-phase kinase-associated protein 1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819203 |
Trichome-related Gene from Literature | N/A |