| Detail of EST/Unigene CA858912 |
| Acc. | CA858912 |
| Internal Acc. | EST636167 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Mannosyl-oligosaccharide 1,2-alpha-mannosidase MNS1 OS=Arabidopsis thaliana E-value=0; Mannosyl-oligosaccharide 1,2-alpha-mannosidase MNS2 OS=Arabidopsis thaliana E-value=7e-99; Mannosyl-oligosaccharide 1,2-alpha-mannosidase IA OS=Mus musculus E-value=2e-47; Mannosyl-oligosaccharide 1,2-alpha-mannosidase IA (Fragment) OS=Oryctolagus cuniculus E-value=3e-47; Mannosyl-oligosaccharide 1,2-alpha-mannosidase IA OS=Sus scrofa E-value=7e-46; |
| Length | 850 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | GLSD; |
| Sequence | GCATTGCTCTATCTTTAGGACCGGAGACCCAAAGTATCAGCAGAAGGTTGAGAATGTAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K01230 mannosyl-oligosaccharide alpha-1,2-mannosidase; Metabolism > Glycan Biosynthesis and Metabolism > ko00513 High-mannose type N-glycan biosynthesis > K01230 mannosyl-oligosaccharide alpha-1,2-mannosidase; Metabolism > Glycan Biosynthesis and Metabolism > ko00510 N-Glycan biosynthesis > K01230 mannosyl-oligosaccharide alpha-1,2-mannosidase |
| EC | 3.2.1.113 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841584 |
| Trichome-related Gene from Literature | N/A |