| Detail of EST/Unigene CA858989 |
| Acc. | CA858989 |
| Internal Acc. | EST636244 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | NAD(P)H-dependent 6'-deoxychalcone synthase OS=Glycine max E-value=7e-62; Non-functional NADPH-dependent codeinone reductase 2 OS=Papaver somniferum E-value=2e-32; Probable NAD(P)H-dependent oxidoreductase 1 OS=Oryza sativa subsp. japonica E-value=7e-30; NADPH-dependent codeinone reductase 1-4 OS=Papaver somniferum E-value=1e-28; Probable NAD(P)H-dependent oxidoreductase 2 OS=Oryza sativa subsp. japonica E-value=4e-28; |
| Length | 548 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | GLSD; |
| Sequence | TTCTCTCTGTTGCCACTATTCTTCCTGCAGTCAATCAAGTGGAGATGAACCTTGCATGGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00930 Caprolactam degradation > K00002 alcohol dehydrogenase (NADP+); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00002 alcohol dehydrogenase (NADP+); Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00002 alcohol dehydrogenase (NADP+); Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00011 aldehyde reductase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00011 aldehyde reductase |
| EC | 1.1.1.2 1.1.1.21 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842289 |
| Trichome-related Gene from Literature | N/A |