Detail of EST/Unigene CA859072 |
Acc. | CA859072 |
Internal Acc. | EST636327 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Plastid-lipid-associated protein, chloroplastic OS=Citrus unshiu E-value=1e-47; Light-induced protein, chloroplastic OS=Solanum tuberosum E-value=2e-46; Light-induced protein, chloroplastic OS=Solanum demissum E-value=2e-46; Chromoplast-specific carotenoid-associated protein, chromoplast OS=Cucumis sativus E-value=6e-46; Plastid lipid-associated protein 2, chloroplastic OS=Brassica campestris E-value=4e-45; |
Length | 471 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD; |
Sequence | GGTGTCGCGGTTGCGGAGGTGCAAGCAACTGAGAAAGTGTCGGATGGTGAGACGGAGAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828319 |
Trichome-related Gene from Literature | N/A |