| Detail of EST/Unigene CA859072 |
| Acc. | CA859072 |
| Internal Acc. | EST636327 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Plastid-lipid-associated protein, chloroplastic OS=Citrus unshiu E-value=1e-47; Light-induced protein, chloroplastic OS=Solanum tuberosum E-value=2e-46; Light-induced protein, chloroplastic OS=Solanum demissum E-value=2e-46; Chromoplast-specific carotenoid-associated protein, chromoplast OS=Cucumis sativus E-value=6e-46; Plastid lipid-associated protein 2, chloroplastic OS=Brassica campestris E-value=4e-45; |
| Length | 471 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | GLSD; |
| Sequence | GGTGTCGCGGTTGCGGAGGTGCAAGCAACTGAGAAAGTGTCGGATGGTGAGACGGAGAAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828319 |
| Trichome-related Gene from Literature | N/A |