Detail of EST/Unigene CA989367 |
Acc. | CA989367 |
Internal Acc. | EST642875 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S18, chloroplastic OS=Lotus japonicus E-value=4e-13; 30S ribosomal protein S18, chloroplastic OS=Lactuca sativa E-value=4e-13; 30S ribosomal protein S18, chloroplastic OS=Vitis vinifera E-value=9e-13; 30S ribosomal protein S18, chloroplastic OS=Nicotiana tabacum E-value=9e-13; 30S ribosomal protein S18, chloroplastic OS=Spinacia oleracea E-value=9e-13; |
Length | 261 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD; |
Sequence | TGTTGTTTTAAGGTTGATCTATTCACGCGTCTAGATAATATTTTTCCTTGGCGACTAATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |