| Detail of EST/Unigene CA989691 |
| Acc. | CA989691 |
| Internal Acc. | EST643199 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Putative serine/threonine-protein kinase/receptor R826 OS=Acanthamoeba polyphaga mimivirus E-value=2e-19; Serine/threonine-protein kinase shk2 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=2e-19; Serine/threonine-protein kinase HT1 OS=Arabidopsis thaliana E-value=5e-19; Serine/threonine-protein kinase TNNI3K OS=Homo sapiens E-value=3e-18; Probable serine/threonine-protein kinase DDB_G0271682 OS=Dictyostelium discoideum E-value=7e-18; |
| Length | 460 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | GLSD; |
| Sequence | TATCTTCCCAAGGGAGATCTTCGTGATTTCATGAAAAGAAAAGGAGCTTTGAAACCAAGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K02677 classical protein kinase C; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K02677 classical protein kinase C; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K02677 classical protein kinase C; Environmental Information Processing > Signal Transduction > ko04011 MAPK signaling pathway - yeast > K02677 classical protein kinase C; Environmental Information Processing > Signal Transduction > ko04070 Phosphatidylinositol signaling system > K02677 classical protein kinase C; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K02677 classical protein kinase C; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K02677 classical protein kinase C |
| EC | 2.7.11.13 |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
| Probeset |
|
| Corresponding NCBI Gene | 827630 |
| Trichome-related Gene from Literature | N/A |