Detail of EST/Unigene CA989874 |
Acc. | CA989874 |
Internal Acc. | EST643382 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Heme oxygenase 1, chloroplastic OS=Arabidopsis thaliana E-value=4e-69; Heme oxygenase 3, chloroplastic OS=Arabidopsis thaliana E-value=2e-64; Heme oxygenase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-59; Heme oxygenase 4, chloroplastic OS=Arabidopsis thaliana E-value=3e-52; Probable inactive heme oxygenase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=8e-38; |
Length | 697 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GESD; |
Sequence | GGTCACTAACACCTTCTCTACCAAATCCAATCCATTTTTCATTATAAAACCAATTACCCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817208 |
Trichome-related Gene from Literature | N/A |