Detail of EST/Unigene CA990086 |
Acc. | CA990086 |
Internal Acc. | EST643594 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S8, chloroplastic OS=Glycine max E-value=3e-54; 30S ribosomal protein S8, chloroplastic OS=Lotus japonicus E-value=3e-53; 30S ribosomal protein S8, chloroplastic OS=Phaseolus angularis E-value=7e-53; 30S ribosomal protein S8, chloroplastic OS=Phaseolus vulgaris E-value=5e-51; 30S ribosomal protein S8, chloroplastic OS=Eucalyptus globulus subsp. globulus E-value=5e-51; |
Length | 614 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GESD; |
Sequence | TGCTAACTTTGATACGCAATGCTGACATGAATCGAAAAAGAACGGTTCAAATACCACTTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |