| Detail of EST/Unigene CA990104 |
| Acc. | CA990104 |
| Internal Acc. | EST643612 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Argininosuccinate synthase, chloroplastic OS=Arabidopsis thaliana E-value=2e-74; Argininosuccinate synthase OS=Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR) E-value=4e-57; Argininosuccinate synthase OS=Vibrio harveyi (strain ATCC BAA-1116 / BB120) E-value=1e-56; Argininosuccinate synthase OS=Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633) E-value=3e-56; Argininosuccinate synthase OS=Vibrio vulnificus (strain YJ016) E-value=1e-55; |
| Length | 675 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GESD; |
| Sequence | GTTGAATGCAATTCTTACATACTCATCCCCAGCTATTGCTCCTACCAAACATGCAAAAGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K01940 argininosuccinate synthase; Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01940 argininosuccinate synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01940 argininosuccinate synthase |
| EC | 6.3.4.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828586 |
| Trichome-related Gene from Literature | N/A |